Similar User
@SarahPerssonYes
@BeckyLowePoet
@_EmilyLC
@RoderickAlan2
@Soozerama
@GeorgeFoxtail
@gemhow
@Rhys_Owain
@Delightedheron
@PatEdwa70504378
@ThePontyPoet
IT'S FINALLY ARRIVED! My first poetry collection, The Poor Rogues Hang, arrived in the post this morning. Order your copy here: waterstones.com/book/the-poor-…
It's a weird feeling as a teacher, starting the year on the tail end of a maternity cover and knowing you'll be gone after half term. It's the first school I've been reliably happy in; I've had a great year and I'd love to stay.
but they were, all of them, deceived, for another three rings were made for the Hollywood sign
Excellent news for the BBC, and the UK, from the latest figures from GAM, the authoritative Global Audience Measure: 450 million people worldwide access the BBC each week, up 3.5 m on last year. 414 m access BBC News, up 2.5 m. BBC World Service radio is up 2.3m to 320 m.
Know your robes - here's our handy guide to the graduation gowns you'll see if you're out and about in Cardiff this week bit.ly/2Ljrq3P #CardiffGrad
Human Since 1982 [Design Studio], 'A Million Times 72v', 2013
I often get the Latin words 'tamen' and 'tandem' confused, so I made up the following saying: 'However tame now, a tandem at last!'
I just designed a lesson comparing Isaac Watts on Bees and Lewis Carrol on crocodiles. With small modifications, I could teach it to every 11-16, KS3-4 kid.
🌟 IT'S ALIVE! The 'Dear Seren' #kickstarter with @foecymrucydd begins today for one whole month!🙌 If you can't donate please help us spread the word and help #Seren get to where she needs to be! 💪 kickstarter.com/projects/jammy… #animation #2Danimation #shortfilm #animatedshort
Our 'Dear Seren' Kickstarter with @foecymrucydd goes live tomorrow! Follow our pre launch page to donate when we go live or if you can't donate but would like to help then please like, share and follow us! shorturl.at/ILW19 #kickstarter #kickstartercampaign #icymi
Theresa May’s parliamentary painting just dropped
The Motion Picture nearly features Kirk fistfighting Jesus Christ. (The Motion Picture, 1978) [Submitted by @tyrrellphd]
I don't have a smartphone, so I can't post selfies. But here's my genome. GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCTGTAGGAGTTCGTTCAATAAAAGTCCTCAAGAGGTTGGTTAATACGCATGTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTTAAATAGCTAGAAGAAAAGCATTGGGAAGTTTCCAACATG (1/21,820,229)
Listen to Me is a short film created with @YepsRCT using the voices and stories of real young people living in Rhondda Cynon Taff to explore themes of Anxiety, Gender identity, Body Image and Bullying. The ordinary nightmares that affect us growing up. Coming Thursday 27 July
Whan that Auguste with his rayyes hotte The oute-of-offyce emayle doth set up theguardian.com/books/2023/jul…
everyone is trying to come up with a copy of twitter when we actually want a copy of 2007-2012 niche hobby blogs with a Google RSS reader that aggregated them into one feed
United States Trends
- 1. #JusticeforDogs N/A
- 2. $CUTO 9.182 posts
- 3. ICBM 187 B posts
- 4. $EFR 2.250 posts
- 5. The ICC 245 B posts
- 6. Netanyahu 523 B posts
- 7. Denver 32,8 B posts
- 8. Jussie Smollett 6.197 posts
- 9. Illinois Supreme Court 6.498 posts
- 10. #KashOnly 40,5 B posts
- 11. #AcousticGuitarCollection 2.304 posts
- 12. Dearborn 6.489 posts
- 13. DeFi 128 B posts
- 14. #ATSD 10,4 B posts
- 15. #AtinySelcaDay 10 B posts
- 16. chenle 127 B posts
- 17. Volvo 5.645 posts
- 18. Katie Couric 2.392 posts
- 19. Flat 52,5 B posts
- 20. Bezos 39,7 B posts
Who to follow
-
Sarah Persson
@SarahPerssonYes -
Becky Lowe
@BeckyLowePoet -
Emily Cotterill
@_EmilyLC -
Alan Roderick
@RoderickAlan2 -
Soozerama
@Soozerama -
George Foxtail
@GeorgeFoxtail -
Dr Gemma June Howell
@gemhow -
Rhys Owain Williams
@Rhys_Owain -
Elizabeth Parker
@Delightedheron -
Pat Edwards (Welshpool Poetry Festival 7/6/25)
@PatEdwa70504378 -
Dee Dickens (she/they)
@ThePontyPoet
Something went wrong.
Something went wrong.